Description :
Non Conding Region
Location :
Scaffold_1:67600- 67705
Sequence
105 bases(100 bases per row)
TATGACACCAAGAAATCAGATTGTGAAGCATGACAATGACTGAATACTTGAGTTCTCTTACATGGCACTTCCGTGTCAGTACGACACTACCTACAACTTC
TCGCT