Description :
Non Conding Region
Location :
Scaffold_1:67577- 67906
Sequence
329 bases(100 bases per row)
GTGATGAGCAATGTGCGGCGATGGTTGGCTCGCCACACATGAATCTATGTGTGACACATTACGGCAGTGGTGGCACCACACCAAATAGGCAAAACCAACC
GTCTTTGTGCAGCTATTCGACCAGCACGAAGACCGTTCATTAAATTCTACTTGGCCTAGTATAGGCTAACTATCATTTCCTGTCGTACTGGTCGGATAGC
CTTTTCGTGGCCCCCGTTCTTCCTGGTCACAACCGAAAAGCCCAGTCCGTCCGCACCAAGCAAAGCTAGGCGCCGACCGACTCGCGTCCCCCCCCTCGCG
CCAAGACCCCCCCCAGACCAGACCAGCCA