Description :
Non Conding Region
Location :
Scaffold_1:67421- 69149
Sequence
1728 bases(100 bases per row)
GAGCAGCCATCTATCGTAGCCGGCGTGAGCGCAGGCACCGCGAGCCTCGTCCGTCGGTCGACCTGTCAGGAGCGTGAGGAGGCCCTCGAGGCGGGCTTCC
TCCATCGCTTCGATGCAAGCTTCAACGTACTACCTGCGGCACTCGATGGCATCGAATTTCGGAGGTTTCCTTCAATCGGCTTGATGTTGCTTTTTATGTG
CAGTATCAAGGCAAAGTATCAATGTATCAGCGAGACTCCAGCACGTTCTTTCTGATGGTCTACCTTGCGCACCATCCATCGATGTTCATCGATGGAGGCG
CGTGCCCGTATGATTTGTGGGCCACGAATCGCTGGAAGTCAAGGATCGATGCTAGGGAAAAGAGTCAATTCAAAATATATTTCTTGACGCGAGTTGGGTT
TGGTATTCCAATGATCGACAACTTGTAGAATCAAGTGAGGGCAGCCAAGGGCATCCCCTTGGGGCAGTGGAGCACGAGTGCGTACTTTTTCAAATGACGA
GAAAGGCCATCATGGCTGCTTTCATAAAATCGGCAATTGGATCTCGGTATCTTTGGCTTCGAAATAGAATGAGTCATTTCCCATCAAGCAATCGACCAGT
TGCTGGTTGCTGGACTCGTCGAGATGCGCCCGACCAGAGAGTGCGTGGCCACGCCCCGAATCGCCGTCCCTCTCGGCGCCGTGCGCTACCTTTTGCGCTG
TCTACTGGCGCTCGCAAGCTTCGCCTACGTCATGTACTGCGCGGTTGTCACTGACACAACTGACTTGCGCGCGTAGGCTGGCGACGGTCCGAGGCTTTGT
GGAGGCACTCGACGCCATATTCTGCCTACCGTTCATCCTATCGGCGGTCGCGCTGAGCCTCTTTGAAGGGGTTCCGCTGGTGTTGGCCATTCGCCGCGAA
GAGTTGGCGGCGAGCTCCACTAGGGCAGCCGTAGCTGTAATTCCTGATCGTTTGTTGGTTGTTTCGCGGCAGCATTACCACGCATCACTCAAAACCATCA
AGGAACCGGCGGGAAGTGCTCTACGCACATCACGTGCGGTGTTAGCGACACCACTTGTGCGCTGCCGACTAGATTCTGCTTTTGGGGGTGAATGGCTCCA
CCAGATCCACACTTTTGTTGGCGTCAGCGCAGTAAGCGTAGCCCACCGGTGCCAGTAGCTGGTGGGGCGATGTGGTGACCACCCTTGGTAAGCACGTGGA
GTGGGTCGACGCTATTCGCTTCGCTCCTGCTTGGCAAGCTAATCTTATTTCGAATACATGCTAAGACCTTATCGCTCGCTCCGTTGTGGTCGCAGCTTCG
GCCACCCTCGGCGACATCGCTGCCTGTGTCAGCGGCGCGAAAGGCTGTTCCCCGGGTGCTATGCACTCCTCCCGACCGTCGGCGCGACGCTTTTGATTCG
GCGCCAATGCGAGTGTTAGCTAGTATCTCCTTGGCAATGTCGTTGTTGTCTACCTCGGCATAATCTACCGCTGGCACTGGCCGCTCCTCGTCTTTGCCAT
CGAGCAGTACCCGGACGCCGCCACTCGTCCGTTCTACCTGCAGCCGCACGCGATGCTATTGGTCAGCGCTGCCTTAAGCGTCGCCACGTCCGCCGACGCC
AAGCAAAGTGGATCACGCCCCTTCTCGTCCTAGGAATGGTTGCGCACTTCCCACGGTGCGCCAAGCCTGCAAGGGATTTACCGACGGCCATTGGAACGTA
CGCACTGTAAGCTGCGCGCCGGACGCCA