Description :
Non Conding Region
Location :
Scaffold_1:67348- 70444
Sequence
3096 bases(100 bases per row)
GCGGTGAAAGACTATGAGTGGGCGTTATCTTTGCGTTTTCTTCGACGGATACGGATTCCTCCATAAATGAACCCGTTGCCATAAACAAAGCACGTTGCCG
TTTGAACTTTTCCACCGAATTGGACTCGGCAATGAAGAACACCAAGCGACACACGACGACGGCGGCGCCGACGGGGCGCGTCAGCACCTACGCGAATACC
AACGCCGCCCGAGCCGATGCTGACACATGTGGGTCGCACCCACCACGTCGCGTTAGCACCGCGAGCGCAACGACAAAATGCAAGCCACCGACGTTGGCCA
CAGCCGCTCGAAGCGTTCGTGCTCGTAGTACCAGCACACCACCGGCGCCAGCCAGGAGCCAGCCCAAGCTGCAATCAAAGGGAATCCACAAAAGTGTCCA
AAATAAGGTCTCTAGTACGACCACAATGAACCCGAGAGCGAGTCTCGTCCATGACGCCGTGCGGCGCGCGTTCCACACCACCACAGCGACTGGTCACACT
GTGGGAGACGACGTCACAGAATACGAGCAGCTGCGCGGCGAACTCGTTCGTGTCATGGCTGATCACCAACGCCAGGCGGACGAGATCGTGGCGCTACGAG
CGCTCGCGAGATCACTGAAAGAGGAAGTTGAGTCCATGCAAGAGGCCGCGGTCGACAACGAGGCTCTGGCTAGAGACACTGCGTGGAAGAGGCAGCACTC
AACGGTAGCGACGTCGTCGCCTTCAAACCGAGAGTTCTTCCAGTTGGATGCGCAAGTCGACTCGCTACGGGAAGAGAATGCAGCGCTCCGAGTGCGTATC
GAGACTGTCGAGCGGGAGAAACGCGAACTGGAGAGCGCGCTCGACAGCGAGATCCCGAGGTGTGAGCTGCTCGCCGTGCAAGCACAAGCCAAACTCGAGT
CGACGACAAGCCAGTTACACGATGAGCAGCGCGAAAACGACCGGCTACGAAGCGAAGTCGCTCGGTACAAGGCACGAAGCCGATCGCCCGTGCGGACACA
GCGAACGAGCAGCGCGGACGCTACGGTGGATGGGAAGGAGAACGACTGCGCGCGAACAAATACTGGTGCGGTGGCACGTGATCGAGAAAGACCTCCCCAC
TACGGAGCGTCGCTGCGAGAGTCGCTGATGTCGTCAGTCGCGTCGCTGTCGATGTCAGCTGCATCGGCCTTCTCGTCGCAGCTCCAGGATGACGTGGAGA
CCCTCAAATCGGAGCTTCGGCGCCTTCATCGGTCGATCGACGCCTCAGTTCTGAGTGCTCGTGGAGGAAACGGTCATCATCGCCATGCGTCGCAGAAGCA
GTCAACAGACCGCGCGGCGGATCGAGAGGAACTAAAGTGCTAGAGATGGTACGGCGAAAAGGAGGACGTTTGTATTATTAACGATTGCTCCTACCGACAC
AAACATGCTAAGGGCCTTCGAACTACTAGAACTACAAGGTTGTGGAGGTCTCTCGTCTACGGCTGCTCAAGTGATACAACACTGGAAAAGGAACGATGGA
CGAAAGCCAGACGGGAAGCTCGGAGGCTCAGAGAGGGGGACGCGGTTGTAATGAGAACCACGGAGCCATGGAGCTTCAAAGGCGAGCGAGTCATGCGCTG
CAAAGCACCCTCACATTTGCTCGTGATGAGGAGCGAGTGAGGGGCTTCACAAACCGCATGGTGTGTCGCTATGCCTTCATGTTTGACGACTGCTTCCATC
CGTTTCCATCCGATGCGAACGCACCAAACGCCGTAGGAAAAAGGAAAGGCGACTGTCGCACTGGCGGTGCTGCGGCCTTGGTACCATCGACGTCCGTACG
CGGGATCCAGCGGAAGGGACATTGCGCTCAACATCACTCACAGCAGTGAGCGACGGATCGCAAACGCTTCCCCCATACTTCGCAGTGTCTCCACGATGGA
CGAGTCGAGGCGAAGGCACCACCGGGTCGACTGGTCGGCTTGGTCTTAGTTATGCTTCTTCTTGCGGCCGCGGTGCTTGCGGATGCGGCGTCGGCGGGAC
TTGGTCGGGCGGTCAGTGCTGCTGTTGTCCTGCTCAGCGTCGGTCTCGAAGTCGGTCTTGTCACCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTT
CGACGTCCGTAGCGAGCGACTTGTTGGAGTGGGTCTGGCGCCATTGGCGCTGGATCATCCGGGCGGAGCGTTGCTGGCGGAAGGCCGCGATCTGCTGCGC
GCGCTGCATGAGCGCAGCGTGGCGGGGCGTCGCAGGTGGCGCGGGAGCAAAACGAGAAGGAGGCAAGGCAGAGGTGGTGGTATCGTCGTTGTTGTTGTCG
AGCACGAATGACAGATCAATAGGCAGGCGTTCGAGTTCTTCGTTGGTCGGGATGTCGCGGTCGCTGGGTCCGCGGCTGGCGCTTCGCAGCACAGGCGCGA
TCGACGCCGACTTTTGCTTCTTGAGCTGGTTGCTGAAAGACGCAGCAGCCGGCTCGATCTTGCGGATCTCAGTATCTTCTGGGCGACAAAAGTCTTCGTC
TTCGATTTCGACTTCGAGCACGACGGACGCCGGCGCGCAGCACACGAGGCGCATCACGAGTCGGTCGTGGACGTGCGAGAGCCAACGGCCGAGCTTCGAG
TCTTTCTTCTGCAGCGTCGGCTGGGGCTTGCGCAGCTCGTCGTCGTTATCGAAGTCGCTGGCAAACGGTTTCATCGCGCGGTGCGCGGGCGACGGAGGCA
CGGCCATGGCGGAGGGGCACACGCACTTGACTGGTCGTGGAGAAGACGGGCGACTCGCTGCGGCGCAGGCAAATTGGATAATGAGGAGAGTGGACAGCGC
TACCGCTCGCTGTGCGACGGAGCTGGTGGGAACAAGTGCGAACGTTCGCCCATCTTAGACATGGCTACACGTGGGGAACTTGTGCACGCCGTTTCAAGAT
CGTTCGCCGATTAAACGCTTCCCATTGGCTATAAATTGACCAATCATATAGTCCTGTTCAGTGAACATTCACCCGCGTTATCAGATACCTGTTTTACGTG
GTATACTTGGATATATATGATAACACAGGATGATCCTGTCTTATCCAATACCTCTGTGCACACAAGCAATATCCCGCCACGAACGCCGCCCCAATA