Description :
Non Conding Region
Location :
Scaffold_1:67260- 67305
Sequence
45 bases(100 bases per row)
agcccgctgccttcttgattagtttttgtattgtgtaatacatac