Description :
Non Conding Region
Location :
Scaffold_1:66833- 67322
Sequence
489 bases(100 bases per row)
atcgttctcgtttggcaaagcaggtgaatgaacaagcagcagtttcaacattaaaagactcttcattcttgaaacttctcgttatttattccagtaaaaa
acacgaaaccaaggcaacacgaatctgctcgtttgccagtcaacaattcgggaaatcttggcaacgatgtctgataatattggtggatgcaacagcttcg
tgttgccctggtcacgtgtcaatgcgtgcactattgaagtattattattcaagtgttggcaaatcaacaataacgtttgctgttcggccttgcaacattc
ccgcgattgcggcgcaaagttgccattggcaatgctgcttcctgccaatgcagttggcgctcctgagttgtttgcataacatcttcagggccaccaaact
gccggttagccatcagtccaaagttgagactttcaactaaccatttcggatttgccttcctctatcaacaatctccagttgcccagcta