Description :
Non Conding Region
Location :
Scaffold_1:66360- 66463
Sequence
103 bases(100 bases per row)
TCAGGAAATAAGCGCCTCTCATTTTCGGTGTCTCTGATTGGTCCGATCTGTACTTCCTGGATTCTGACTCATTCTTCAATTTTGGCTTCATTAATCGCCA
AAA