Description :
Non Conding Region
Location :
Scaffold_1:66154- 66439
Sequence
285 bases(100 bases per row)
ATCGCCATATGCACACAAAGTGCTCTTAGCGTCCGAAAGGTCACACTTGTCATGCACTTCATCATGCTCTATATAATTCAAGTATCGTCATAAACATGTC
CAGGCATCGATATAGACAATATATAATTTTTACGTTTGCAGCTTGACTTTGAAAGTGCATAATCGAATCTTGAGATGATAATGCATCGTTCAAGGCTGAA
ACGATTGTCAGCTTTGAAATACCGGTATGCATACCGTTATTGTTTCGATCATTCTCACTGTTGTGTCAGCATCACTCAGCGACAA