Description :
Non Conding Region
Location :
Scaffold_1:65728- 66690
Sequence
962 bases(100 bases per row)
GGGgCGGCGCGGTCTAACCGGGGGgAGTTGGGAAGAGGTGAACCGGCGGCCGTGTTAGTCCCGTTGGGGgTGgTGTTGGCGTTGGCGTTGGGTCCGGCCA
CGGCCACCCGGCTTCTGTGCAGGGCGTGCGTGTACGTGGTGGCGGGGAGCACACGCTCAGgTGGGGGGATGGCGGTGCGGGCGTGTCGCGTCAGTCAGTT
AGTTCAGCTGCGGTCGCTCTCTTCCGCAGGCACAACTCGAAGCACAAGGCGATGCGTTAGACCGACCGACTCGCACTCTCGCCCAGGGACTAACAACAAC
GCGGCTATCGATTCACGTCAAAGCAACTTGGGCGGCCAAGTCGCCTGCGGTGACAAAACCGGAGTGTGGAACTGTCTTCTCCGCCTGGATTTGTGTTCGC
GTTACTTCACAGCAGAAGCTCCGCATTTCGATCAACCAGATTCGTCCAAATCGGACAAAAGAGGAGGTGATTGGCCGATAATCACCACCCGGCTAACTTC
GGCTCATCATCTCTTGACTGCCCCACACCCTTCGTGCCAAACAAGAGAAAAGATCCTGCCTTCTTCACGCACAGATGAACGTCCGAAAGCACTGACGACG
ACAACGACAGCGCCTTGTGCATGAGATGAACCTGCAGTTCAACGTTCTCTCTTGTACTGTACTACCACCGACGCTTCACTGGATTCGTTGCCGTCCTAAC
GGTCGATTGATCATCGCCTCGTGTTCTCGCGTTCGCGGAGACGTCACTCAACTCCCCTTGTGAGTCACGTCACAAGTTGTGACCATGAAAGGGCAAGGGT
TAGCGGAGCAGTTGACAGCAAAGCAGGAGAAaGGGGGAAAGGGCTGTGAAGTAGCGCGAACTATTTTTCtACTGAGTCCCTCAGAAaTCATCGCACTACG
CAAAACATTTCACCGTACGAGCACATTGGCACAATATTTTATGGGGgAGACATTTGACATGT