Description :
Non Conding Region
Location :
Scaffold_1:65667- 66230
Sequence
563 bases(100 bases per row)
GCTCCGACCCAGCTACTGTACGTCGATCGAATACATATTCGGGTGAAAGCTACCTTTTTAAGGTCCACAAATGGAGAGCGAAGAAACGCTGAGCATGTGA
CGTGGCAAGGAATTGGGCTTACCACCAAAATCTTTAGTGGCGATCGGCACCAGCCACTTTGGCCACCTCGAGGAAGCTTTTTTTTCGACCTGCAAGGTCT
GCTTGGGTGCCATATTCAAATCATCCACTTGCATCCTTTCTGCTTGGTCTAAAGTCGCTTGCACATTGTGCACCAGTACTGTACTTCGCCGCGCGTGCAA
ACTTGTCTAGAGGCGATGTCACCACGACTGCATGTACCATCGCAACGATTTCTATCGTACACCGAGCACGTGATCGAGAAACTGATACATTAACCGGCAT
CTTGCCTTCCTATAGCTCGTATCTCGTTTTATTCTTCCGAGACGCAGAGCAAGATTCGACGACAATATAAATGGGGTTGGTCGAGAGGACACTCGGCGCT
TCACCGCCCTCCGCAAAGACACGACCAGACCGGTCGACGAACTGTATACACAAGCGGCGCGCT