Description :
Non Conding Region
Location :
Scaffold_1:65579- 67258
Sequence
1679 bases(100 bases per row)
TACTCGCTTGTGCAGCCGCCTGCAACGCGGTTGGGTGGCTCTTTTTTATTCATGTTTCCTTTAAAAAGGTATCCTTTGCATACAAATACCAAGATAGTTG
AATTAATGGAGGAAAACGACATGAAAAAAAGGAATAGAAGAGACATGCCAGTCGTGTTTCAGAACACCATTTACCATTGGATTCATGAAAGCAAAGCAAA
GGATATAGTGTTGCAATGTTGCACGACGGTCGCAAGCGATGCGGCACGAGCGACGCAGTTTAGGGCTTGTTAGTAAGGACTATTACATAGCATGTAGTCG
ACTGATATAGGAGAATACGATGTACAGTGCCAAAATGGTCGGGTTGGCGGTATCCGGGCTTTGGGAGGGAGCAGAAAGGCGCAGAGAAACACTGTCGCAG
TTAGTACATGGTCTGCAGTCGACTAGTACAGTCTACTAGACCTGCGAGGTGGCTGCTGAAAGCGATTGGGAAGAGTATTCAGTAGCTCGTCGCGATCGCT
CACCAGCGTGTGACGAATTTCAACTTCTATCAGGATTTGCTTTCGGCCAATCAAAAGCGTTGTGGACACCATTCGGGCATTGATTGGTCGATTCACGCTG
ATTGCCCACTATCCTTGCAGTTGCCCTCGACCACCGCGCGTACCTAGTCCTCGTTTTCTAAATCCATGTAGAGATTCATGAAGTTGTTGATGTTATGGCA
GCAAGGACATTCAGTAGTAGGCGGCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGA