Description :
Non Conding Region
Location :
Scaffold_1:65348- 65928
Sequence
580 bases(100 bases per row)
ACCTACAAGTCTTCCAAAGTAGTAGATCGTCAGATCTGTATCCATGACTGTCAGCGGCGCCGTCCTAGAACGTCTTCGCCTTCCGAATCGGACGTCTCCA
GCTGCAATTCTCCGGCAAAGGCCTCGCTGGCGCGCTCGGTCATCGTTGAGACTTAATATATGACTGGTAGTTCACAAGATGACATGAACCATTTACAATA
TAAACATAGCGGCTGAATAGCAGCGCAAAATGGCACTTCAATACGTTGAAGTGCCCACACGTTGGAGTGATGTGTTGGTGTCCGTCTATTTTTGTTTGGT
GGTGCCGCCATTTTTAAGTGTGGGTGGCCCTTCTAATCTCGTGTGTGTGGTGCTACACCGATCGTGGTCGGTACGGCAAtgacttgtgtcgagattccgt
aacaaaacggtcatacagtgaagtagcacgTGGTGATTTGATATAACTAGGCATTTTCAAAGATCACTTGCAGAGCTCAGCACAAAGGCTCCGACAAGCT
CAACATTGGTAAGAGGAGGTTCGCCAACGCCTTTATAATCATCTTGCACTTATCTATCAGCTATTTCTGTTGTTTCTcac