Description :
Non Conding Region
Location :
Scaffold_1:65253- 66238
Sequence
985 bases(100 bases per row)
GTGTTGGAAAGAGAAGggagaactggaagctggtgttggagctTGGTGGTGAATTGAATAATGAACTTCTTGACAGGACTTCAAAAGCGGATCGGAAGAT
CTGCTACATGGTTCTCCTACGGGTGAGAGCTTACAGAAAACAGCAAACGTTGACTATGCGTGGGCAGCAGGGAGCCACAGCACTTTGTCAGAAGGACGTA
GCACTTGCCATGGTggcttcaacaagatgaagtggtCCATTTCACCGTACATTTGACCAAGATTGTCTTACCAAGACGTCACTGGGTCTGACCCGGAGGG
TCAAGAATTCGGCTGCACTTGTGACTACCGTAGCATGTTGTAAAGGCACCGAGCGAGCTTGCTGACTTGGAATTTGAGTCTCTCGGTGTCACGATGGtcg
ctgcaacttcaacttgaacacAACTCCATCCCCGCTGATCCTGTCAACGGTGAGACTGGGCGACTTGCCCCTGGTTTCAACGGCGGGATGACAGAATTGC
ATCCATCCATCGTTAGGAGGAGCAACACGAAACTCCACGGCAAAGCTTATAGTTAGTGTAGTATCGACATCTCGGAAAGTCTACGGATGACGTCTCAATT
TGGGAGTAGCGCCACTACTGCTTGATCTGCACCTCAACGCGGTCCAAACTCGTGGATGCCATTCACAGTCTCTTAGTCGCTTCATCGTTCCGGCGTTACC
GTGGCCTTGGCCTTCCCGTCTCATTCTACCCTGTGGCGCACAATCTTCCTGCGATCAGTATTGCTGCCgtcaaacaccacaacaTATTTTTGTGAGTCTT
GCACGTCGACATCACGCTGTGTTGATTCGGCTGCCGTGCGGGAAACTCTAGCTACTCACGAGAGTCATTGACGTCCTGCAGACTAGCTCACGCCTGTGTG
TCGACTGTGTAGAGCATCCATCCACGCTATGTACGAAGGGAGCGCTGCAGACATCCAAAACTGACGCTGTGTGGCTTGGCCATCA