Description :
Non Conding Region
Location :
Scaffold_1:64866- 66087
Sequence
1221 bases(100 bases per row)
CCAGCAGCCGTGCTCGCGTTTGAGGGCTTCCAGTTAACGCTTTATCCCTCCCCCATAAGTTTTGTCTTTTTTAATATTGTTCATACTCATCTTTTTGACC
TGATGGACTTCTTTCTCCTTGGATGACACTGAATGTAGACATTCGCTTGGCTCCAAGTGGGTCCCATTGTCTCTTCCTCCTCCCTTGTCTTTCCTCTGCT
GTACCCCCTTCTTCACTATGTCACTGTCATTGACGGATATAAATTTCGCGTGCAGCCTCGGAGAGCTTCAGCACTTGGGACCGCAGGTGGTCATTTCGAG
CCTCGTTGTTCATCGCTCGGAACGTGCACCTTTCGCTACGATGCTCGTGGAGCCACTGGACAATGTCTAGATCGCCATTCAGTGCAGCTCGATCCATCGC
ATACGTAGTACACCCCCGCTTCGATTCGCATGCAGCCACTTGACAACGTCGAGGTACCTTTCACAAGCAGCACCGCACTGGCTCACGAGAAATATGACGA
CGTCAAGGCGGCCATTTGCCACGACATTGGCGATCAAGGCCGCAGCTCAAGCTCTCCCTGGTCGAAAAGCCACTGGCGACCTCCACGTGACCGTCAGCGA
TTGATGGATAACGCTGGATGTGAATGCTGGAGTGAGAGACCGAGAGATATCCTTTGTAGTCTTGATACAGATCTGCAAACGCAAAGAATGAAGCCACTGT
TTAGATAGGATAACAAATACACACCGGGTTCATCGACGGAGCAATCGACTGCAACAACGGATTTGAGAAAGTCAATAGCAGCCACATACATTTTGGAAGG
AGCAGCCAATGAGTACATTTTTCTTTGGTCGAACAGCCTTGCACTCTGGCTCAACTGCTTATCGAATGATGCGTTTTCAGGTGCAAAGCGTACATTGCCA
GCATCAGGAATGGTGATGACAAAAGGGAGTGCAGGGTGGTCCACCCCGACTCCATAACCATTCGCGTCATCTTCTTCGTACCCCTTTCCTCTCTTTACAG
GAGGGAGAGCTGATGAGGAGGTAACCTCCTCGCTTAAAGTTGCCTCTTGTTTCAGTTGACATCACTGCTGATAAGTAGCATTAGTACCGTCTTCTCGCTT
CGCCTTGCTCGCTGCTTCCCCGTCCTGGCCCGCAAGTAACTCAAGATGAGGTGAATCGTTTGGTACGCTAGTATTTATCGCGATTGCCAGACTTGTGGTG
GTGGTGGAATCATCAGATACC