Description :
Non Conding Region
Location :
Scaffold_1:64713- 64887
Sequence
174 bases(100 bases per row)
GAAGCCTGTTCATACGCTTAGCATTGAGTAAATCGATTCGACAAACAGCAATTGTGAACGACAACCGAACTGAATCACATCAAAACGAGTTACTGCATTC
ATGCGTGTGGTTATTACGAGCTACTGACACTTCCTTTCCTCGTAATTGTTCTTGTAGCGAGTTGGTCGTCCCTT