Description :
Non Conding Region
Location :
Scaffold_1:64321- 64409
Sequence
88 bases(100 bases per row)
CTACTATGCCATACATAGGGAGTTTTGTTGGTGTCTGCTAGTCCAGTACCCACGCTATTTTTTATTACTCAACACATCACACACTTCC