Description :
Non Conding Region
Location :
Scaffold_1:64027- 66784
Sequence
2757 bases(100 bases per row)
CCTCTGTAGCTAGCCTACACTTTAATGCACACACAACGTTCACTTCAACTTGGAGTTTTCCCCCCAACATTGGTTGCACGTGTAGTGCTATTCATTGCCA
CTCGCTGCAGGGTCGCGGCGGGTCTGTCTGGGATAATGGGTTTTGGGGTAAATGAACATCTCACCCAAGAGGCCGAGAATAAAGTATTAAACTACTCGCT
GAGGCCTGGAAACGTATCTTGATTTAAGTACACTGCTGTTCTTATGGGATCTAAGATCCGAGCTTGGGGCTCTGTTTTCTCGACCAAGGCGCTTTTCTAC
GACTTGAAAACGCAGAAATGCCATTCTGGACGGGCCAAACCGAGTTTCTGGGCCTAAAAGCGGCCCCCAGCAAAGCATAAAGCTAAATCAGCCCTCGCCT
ATCTCGTGTCCACTCATATTAAGAGACAGGCGTGGTCTATTTTAGAGGTCTATTTTAGAGGGCAAAGTATTTGCAAGCGGCAATAATCCAGAGTTGTTGG
GTGAATCCCAAAACCCTACCAAATTTGAAATGATAGCACCGTAATAGATTTATGTTTGCGTTAAACCGACGCAATCATTTCACGACAAAACTGAATGCTC
AATACACAGGCATCAACAAACTAGGCACTTGGTACATAAACAATCCAAAGTACCTAAATGGAGTTTTCAAAATGTCCTTAAGAGAATGGCTTCAGGCTCG
GTTCTATAGTAAATAGTGGTCCATTGATGGTTATGTCGTTGGTACATGTATTTTTCGGTGCTTTTATCTTATCTAGCGCAGTAACAACTGGGCTAGAACT
ACTAGAACCACTCATTCCGTCGCCGCTACAATAACCACTGCCACCACCCTCCTCCCGTTACTTTCGTCACTGCCTTCAAGCTTCGCGCCAATATAATTCG
TGCTAGCTCGACCTCCCTCTGCTCTGTGCATTTGGCACGCCAATGAAGCTCTCATACATGACAGCGCATTCCGCGGCAGCCGTACCTGCCAAATTATTGA
CAATACACATCGAACATAATGATGGTCATGAAACTCACTCACTCGAGGAACAACCATATGTACCTGTAATATCACATACCAGAGTATTAAATACTAGAGG
TCTACTTACCAAAGGAAACGAAGCTCGGAAACCGTAGCAGGATCTTTGCCAAACTGTGGAAGCAAATAGCAGAATGTGATACTTAGTATAAGTGAGATGA
ATGCCTCATCAGCACACCAACATATACGTGCATTTTGCTAAGATGCCCTCATGTAAAAATTTGAGCGGCAAGGACGCCGGAAACACTGCAAGTAAGCTCG
CCATCATGGGGCTTTCGCCCAATGACTAGTGTTGGAGGATCTCAATCGCGTTGCTCTGATGAGTTGTATTGTAAATGAACACACTGCAGTGGAGCCTTCA
CTACAACCTGTACTATACAGGCCGACGCCCCCACCCTTCCAATAGATTAAAAATAACCATGATCATGTTTTATATCATTGTGTTAAACAAATCAGAGTCT
CGCGTTAACCCTTTAAATATTAAGATCGACGAGTCGAAACTCAGCGGAACACCATGTCAAGTCGATACCATGTTTAATGATACCTTGCTTGGCATGCTCT
CCGGTTCCTATTGGTAGTGAGTGGTTTACACCTCAAACACCACGTGACAATCAGTTTGTGCGGAAAGAGGATCATCTACGAGCAATCTGAACGATCGACA
AGGCACAACCGGCGAAACTGGGTGGCTTCATTGAGCAAAGAGTCTTTGCCAAAGACGTCGACCAAGAAAGCTGCCACCTACTACAAACGCCAACTGTACG
TGCGCTTGATGAAAACTACAATCCCTTTTACTTTATTAAATATATTGAAGACGAAGTTTAGTGAATAACACAAGTGGGGCAATACTGTATCTGTAAACGT
TCATCAAAACATCACGACCCATATCAAGCGAGCGGCCCTGTAGACAGCAGTGTGCGATCCTAGTATTGTGCTTTGCATCCACTTAGTGTTCGTACACTTA
GCGGTAAACCATAGTGGCCTTGAATGCGAGTTGCTAAGTCGTGTCTCGAACCCGGTTTGGTTCGGAAATGGCACTTTCTAAAAGTGCAAAAGGTGCTGGA
TGTGCTAAATCATGCGGGAGATGGCGTATGCGCACTACTTATTAGTAATAGTGCTGATTGACCATCCACGACTTCGTACTCGAGTACGATTTATCAATAA
GTCATGCTCGATAAGTCGTACAAGTTACAGTCCGAAGTGCCAAAAGTCTGCAAAGCACAATACATGTAAATAAAAAAGGACAGCCTACGCGCCCATGTTT
CCCAGGTTAGAAAAATACTCAGATTTCTGATTCTGCAGGTGATGCCCCAGGTTATATCCAGGTATATGAATTATGAGCGTTATCAGATGAATATAATTTA
AACAAGGATGGTTAAATTACCAGAACAGTTAATGTCCAGGTTAAAAACCTGGAAAACTCATGTGCGTAGTACTTGAGGAAAAGTGAAAATGACGGCCTAC
AGGCTGTGTCGGATGCATTCTAGCCATTCATTTCTTGTTTCAGTGTCCAGGTAGTTTGCAAGTATGAAAACCTGGAAAACTCATGTGTGCACTACTCGGA
AAAAAGTCGAAGTGGCGTCGATGGGTATCGATCGGAACCACACGACATTATAATGGCTTCAAAACAATCATTGTGTACCCATCTACTCGTACAGGTTGCA
AACAAAAGTTGTCCATGTATTATCCATAAGATGCACTTCTCGCTGCTGCTCACTGTC