Description :
Non Conding Region
Location :
Scaffold_1:64018- 64325
Sequence
307 bases(100 bases per row)
GCGCCGGTTGACGGACGAACACTGTTTTGTTCCTGGAAAATCCTGTCTCATGCAACGCTACTCAGGCGCTGTTCTCGCTAATAGCGAGTCTCCTTGCTGG
AGAAGATGGCTCAGAGGAGCAGAGAAGCGGGTCTGGTCGGAGATGAAGCCTCACGGGCAGAACCAGTGCGCGGCCACCACGCGAGGACGCTACAGAGTCT
AGGAGGCATTGACGAGGCCGACTAAAGTAAGATAACTGCTGTACATTAAGGGTGTGGTGTGATAGTAGCTACAAAGTGGTGGCTTCTTCGGGTCGAGGTC
CTAATCT