Description :
Non Conding Region
Location :
Scaffold_1:64005- 64613
Sequence
608 bases(100 bases per row)
GCCCTTGCGAGTCGCTGGTGGTGCAGTGAACAGTTGATCCAGAGCACCAAGTGCATCGCGAAGCCTGAACTCAGGCGAGTCAAAGAATCCAACGTTTGCC
GGCGTATTCAGGTGACGAAGCATGACCAATAGCGAACGTACAGAGACAGTAGAGGTGTTCAGGCACAACCGAGCATGATCTTCTTCTCCTTTGGCGTTTT
GTTCGATCTCTTCAGTCGAGGCTCGACTGCAGTTCGCTTGACTCAAACGCCCACACTCGGCGAAGAGTTTATACAGTAGCACGTGATGCTTCTTGAAGAT
GAGCTGCATCTCCTTGGCGTACAACTGAGTTCGCAGGGTTCCCAGCCAGCTATCCGCCTGCAGCTGCTGCATCTCGAGCCGATCCCGCATCATATGCTCG
TACATGTCTGCGAACGCGTCTGCGAGGGAGAACGTACCGATCGCGTCTCCGTCGGTTTGCATTTTCTGCCAAAATGCGATGCGGATGAGCATCTCGACAA
ACTCGCGATAGAGGAGAAGCTGGTCGTGTGGCACGAGAGCCGCGCAAGTGGAGCCATCGTCCGGGAGGTTGTTCTTCAATTCCAGTTCTTCAACAAACGG
GAGCACGT