Description :
Non Conding Region
Location :
Scaffold_1:63850- 64285
Sequence
435 bases(100 bases per row)
GACTTGCGTCTGAGGCGGCAAATTCGAAAGTGAGGAGGGCAGCTGGTGTCCGCAGTTGAAGTAACGCGCTCAATGGCTATTCGACCAGCACCAATGCATT
CAAACAGTATTTACCCCTCCAAATAAGCACGATAAACTATTAGATGGAGCAATTTGGTGATGGTCGGATAGCCTCTTGtttgacaagttgaagctcaTGC
TttagttgaagtggtggatATGCTTGAGGCATTGCAAGAAGATACGCTGGACGAGTCGTTTCTCCTCCTTACATCGCTTGCTCCATATTTATCGACCGAC
GAAACCCCAGGCCGACCTGTTCTATTCAGAGGCGTGGACGGTTAGTGCGGTGCTTCATTCCGCTCCATCCAAACTCGGCACTCTCACCTCCTTGATCCTC
TGTCTTTCGCTGTGCGTGGCGGAGCGAGTGACCCA