Description :
Non Conding Region
Location :
Scaffold_1:63821- 66507
Sequence
2686 bases(100 bases per row)
GTTGTCTTCTTGGTTTGGTTTTGCTCTTGCTGTTACGTTCGTAAAACAGGCGCTGCTTAGGATGCGGGACTGTCGTACAGACGCAGGATGATGGAGGTCG
CGGATATGTACACGAGGGACTAGTTACGCTCACAGACACACGCACGCACGAGACTCGCACACAGACACACACAATGGGGGCGGAAGATGCGCGGGCGGTG
AGGAAATGCTGCCTCGTGGGTTTCTTTTTTGCGGAAGGGGAAGGGTGGTCGCCCCGCATACGATCCGGAGGCACCGGTTCCATACCGGTATAATTGACGA
AAGTAGCACGAAGGTTGCGTATTCTCATAACGTTACTTATGAGTTTACCCGTATTATATTAAAAAATATTTATGGGACCGTATCGTATTTGTTTCGTGTA
CCTTACGAGTTGTTGTGCGTGCGTGTGTGTACCCATTTCACATTTTCTCTCTCTTGGTCGTGATGGTGCGCGCGAGCGTTGTGCGAAGGCCACCCAGGTT
CGCCTTCATGCGCGACCGCGCCGACAGGGTCTCCGCTTCCTTGGCAGCACTCCCGCGAAGCCACGTACTGAGGATGGTGTCGAACCGCTGGAAGCCGTCG
AGGGACGTGAGCTGGAGCTTCTGACGCCACGCGTCATTGCTGGAATAGTACATCAATGGCGGCGGTGGCGATGCGGTTGCGCTGCGTTCCTTTGAATGTG
TTCGCACGGGGTGATCGTCAGAAGCTCGGGGAGACAGCGCTCGTTTCAGCCGGTGGTTGTACTCGATCTCCAGCTTCGCGCTCCACGTGCGAAGGTACGC
GACGCCGTTCTCGAACTGCGCAGCGAGGATCTCGTTCATCTTGGCATTGTCCACGACAAACTCTCTGTCAATGAGCAATAGCGCAACAAAAACATTCTCA
GTCAGCAGCATACACGCTAGCCATTTCGATTGTGCTACGACATACTCGATCGTGACGCTGATGCACGCTTCCAGGACTTTGGGGAACAGATACACGCGAG
ACGGTGACGGGGACGCGACCACGCGCTTGCCGATCGGATCCAGCAGCTGTAACACCAGGAGCTCCATAAATTCAGTCTGCACAAGGGAAAACGATGGCAT
TGCACGGTCAGTGCATACACCACAAAGAGACGCGGTCAAGGAAGGCAAATGATGCAATAAAGTTGGTTCTAGGCGTATGACCTACAGCGGATCCTCTCGA
CTTGGACGTGCCTTTCGACACGAGCGGACGGCACAATCGGCTTGCAGCCTGGACACACGTCGTACGAAATGGTCAGCACCACAAATTTATCGGAGGCAGC
GAGACCATTAGTGCTGTCCCAGCATGCACATCCCGCCACTTTCCTATGGGCATCGTACCAGTTCAGTCGTCTCGAGAATCGATTCCGTGAGCTCTGCGAG
CCGCGTCTTGAATTCGGCGTACACGAGTTCAAACTCGAGCGAGATCTTCGAGATCTGCAGAATGTGGAATGGCTGGTTGCCTGCTTGAGGAAGCGCAGAC
AATGACGGAGATAAGCCTGAGGTTGCAGGTGGTGCTGTTGCGGCGGGTCTCGATTGCCAGTGGTGCTGTGCGTCCGCTTCGATGTTTTCGTTCGCCTCGA
TCAGCGTCGAGACCTTCTCGCATGCCACCGTGACGTTCATGAGTCCATCGTGGAGCGCGATCATGCTCAACAACGCGCTATTATTGCTGCCACTGTTGCC
CGAAGTAGTGCTTGCCGCTGTTGCACGCGGACTAGTGCCTCCACTCGCATTGTACACAGTCGATGACGACCACATCGGCCGAGTCGCGATGATCCACGCG
AGATATTTGCGCAGTGACGGTAGCAAAACCGAGAGCAGCATCACAAATGGACACACTGGTAGCGCACTGTCGTCGCCGTCGTCTGGATTGTGTTCCGTGG
CGTCCTCGAGTACTTGCGTGATCCCAGCGAGCACCTTGGAGCCCAACTCGGTGATGGTGTCTTCTTGGAAGTTGTCGTGGACCGGGAGCTGCAGCCTGCG
ATGCAGTTCGCTCACAAGTTGCGCGCACTGGCAGTAGAACGCCGTGATGCGCGGACTTCGGCGCTGGAAGCTCGTCGCGTTGACCACGAGCGGGCTCTCG
AGCACTTTGACGCACGAGGCGCTGCACGGGACATCGTCCTCATGCGCGCACAATTCGCACGTGGAGCCCTTGCGGGTGCTGCTGCTACTTGNNNNNNNNN
NNNNNNNNNNNNNNCCGCTGCTCTTTTTCCCTTTTTTCTTCTTCTGCGTCCGCATGACTCGTAAATGTGTGCTGTTTCGTCAAAGCAAACACTGGATTCA
CAAGCAAGTTAGCGCTCACACAATACACAGCAACAGCACACAATGTATCAAGGCTATAACGGTCTCCATGTTCTCATAACGGTCTTTATGTTCTCAACGC
GTTACGGATGTTTACTTTCATAAATATAGCGCATTCCCAAACCTTCGAAACACCATGAAACACACACACTTCAATGAAGGGTTTTGTCACTCTCACTAAA
CGTTGTCAAACGGAGCACACAAGCAATCACACGAACGACATAGTTCCGCCATACTTGAACAGCCAGTGTCGAAGAAGGACGTNNNNNNNNNNNNNNNNNN
NNNNNNCACTGGGGTTGAAGGCCAGTGTATTGCTGCGCTTGCCTTTGAGATGATGGGGGATTCTGAGCTGCTGCTTGTGCTCTTTT