Description :
Non Conding Region
Location :
Scaffold_1:63750- 66221
Sequence
2471 bases(100 bases per row)
tagtgcaatgatcagagctagtcgccaccaaaattactgaaggcatgacagcttccagtcagggtgacgaagaagaggaagagcgccgagcccttgaacg
agaattagcggccgaattaactgcattaactgctgaggacgtggaatttgacgtggctgacgacgttgtcgactgggcgggtagaaatggaggaagcgag
atggactacgtacgtttggacctcaacaaggtgttgcagcaggtgtcggatgaaagacaggatttgcacggccaaacgtgggggctactgctgcaaagtg
tcgagcgcagcgaccgtgagttcttccagccttgccatgaaaacttgagcgaaatccgctcatcaatcctggaagtggaagctttcaaagcttttgataa
aatcgacaaagaagcagctcaaccgagccttcaacatgctgaagctccccgacctgaacaatctccgttgctaaatcctgtagacgaatgccgaggagag
attgccacagcaaaactgtgtcaaggagctacttctccaactgcacttgatcacccgactgaaacttcatcatttgcagagatggacgctcaaaccattg
caaaacagcccgaagacgacgaaagtatgtggaaggacctgcaggctattgaaaagcagcacgaagctcgacaattgcggcgtgtgaaggctcaagctca
atacgagaaggagcaggctgaggcagctcaatttctgctccagctacaaaacgaatttgaaatccaagagaaaaaagcggaagttactcgtcgtgaggct
caagagcgttcccttatggcctatgaagatgcactttgtcgggtagttgctgttgtcgaacgtgaagcacacgaatgtctatcaatggtcattgccgata
aagaatctcgtcgttttgcagatgagttgacccgattacaagacgctatttgcaaagagatcaccctgatggaacttgaagatcgagcagttcgaaagcg
aatgcaagtagaatggcaaacacaagaagctgctgcaaaagttcactttgctgcagtattgctggaactggcaaattatcacgaaaatcaacgacaactt
caggtccagcaaacgaaacgagaacgtcgagaaggtgtagagatgcgagctgaagaagcccaaacgtggcggttaatagctgaactccgtgctcttcgtg
aattgcaggaacgtgaaagaaatcggatgttaatggttgacgaagacaagttggccagtgtgtttgaacagctacagagacgtcagaagcgggaggaaac
agatcgcgttttcatggaggaagaagagaaacggactcggttagcgtggactttcactgagacgttgcggctcgtacaattgaagaatgaagaacgtagt
cgacttgctatggagttggaagaaattcgttgtcgacgtgtctggaaatgtttatccgaacttgaggcgagtgagcgtgaaacaatcgcttacggatttt
aagcaatctatccacaggtttccagcgtattgagcaagtatttcgacaacacaccttgttagcgtgctttgagcagtggatgtggtggaaggagaagaag
attgaggaagacaatgttcgatctgccacggagtttgaggctgcaatgagaattcaaatatggcatcgatcgcgccgaaaacggcagcaattggacgtgc
aacctcctctcgtcctcgaagatttcagcgaggaagagcaaccgcaagtcgaagaggaggagctttatgctaattcgccgcaaaaccaagaagcagctct
gcgtttgcaatcaacttttcgaggtttctatgtgcgacggaagtttgcaaacgctattgcactggcccaagttgttggagaacacgaagatggagagttc
aacgcggtggatttagacgatctgatagaactcccgcctgagctggtcgatggctgggaagatccagtgctgccatcttcctcggttcttactcaacgac
aatacccgaatccagaaattgcagaacgtgaagaaatacgagtcaatcttgatgataacgatgcagaatggatgagcggtgaagatttgcaagacgctaa
gcctttgacccctccagcgcctaaaaagcctgtaaaagagcaaactttggcagcaacgctatggaacaaaatgaagcgagtgaagcaacgccagcaacac
tcgcaacaagagcggaaacggcagcaagaccccatctaccgagtccagaagctgctcaacggcaggtccaatggcaacaaccaaagtcacagccgccaga
ccccacaaggaaatgtaaaagtatccaatttgatctcctggtcgtcgactaacaatgtgaagaaaaagcccaaagtaaagctaccgtctttggtggagcg
actacggaaacaaacaatggcagagcgatgaacacactggaagtattgcagtgtgttactacgaccgagct