Description :
Non Conding Region
Location :
Scaffold_1:63641- 63742
Sequence
101 bases(100 bases per row)
TCGAATTTTAGATGGAGCAACCAAGTGAAGCGATGGCATCGAAGGCGAAAGAAAACGGCTCGCTTAAGGTATCATGTACTTACACGTTCTTCGCACTCTG
C