Description :
Non Conding Region
Location :
Scaffold_1:63305- 63879
Sequence
574 bases(100 bases per row)
CGGGAATGAAAGCTCTGGCATGTACGCGGTCGAATTTGAGATGTTGATAATTTGACCGCCTCATGTAAGccattgcagtgcaagctGCTTGTTGAGTGTA
TCGGGtttggcgttgctgtacTAGTCGTACAGCTTGGTGCGTATTGGCATTGAATCGCGAATTTACCTCACTCAGTATGTTTGAACTTACATTTTTTCAA
TTCGGATTGAGATATCTAACCTCCTAACCAAGCAGGCTGGCCGCTTGTAGCGATGCTACCCCGTGTTGCGTCCGATGGCGTGAGTGCTGCCAATTGAAAC
CCTTGATgacaaaagaaaaaaatgacCATCATCACAATTGTGTCGCCGGATGGCGTGGGTAGACTACTTTACGCTTTTCAATAACAAATGTACTCTGCAC
ATACCATGGGTTCATCGAGGGGTACATCGATGAATGTTGACAACCCATCGTCAATATTTCATGCTCTGTGCCGTTAGCTTCGCTCAAGCAACAGACATTA
ATATCACGCACGTTGCTCTGCCAAAGCTCAGTCGACAAATGTCAAGGCCACCGCAAGACCGTTCAACACCGTTA