Description :
Non Conding Region
Location :
Scaffold_1:63275- 64791
Sequence
1516 bases(100 bases per row)
GCCAGAGACAATAACGTGAGCGAAGCGGTTGAATCTTCAAGGGAAGAACAACTGAAAATGTTCGAAGCCAGAGTGGAGGAACTCGAGGATGATCAAGCCT
CAAAGGCGGCAGAAATATCTAGCCTAGAAGGTCGATGCACCGAACTGGAAACAAAGAACAATGACCTCCAGCAAAATGAGCTCGAAATGGCTTCGATCGT
TAGCCGACACGAGGACTCCATGAAGAGACTTACGTTCTTAGAAAGCGAGTTGGCGGCAAAGGCGAAGGAATGCGAAGAGCTAAATCAAATGCTGGCCAGG
CGTCATACAACTGATACGCCTCCATTATCAACAGCTAGCACGGCCGATAGCGAGGTGTCTGTTCAGGCAACAATCGAAGAAGACAGTGAATTGGGTCCTG
AAAAGCGTGGTCAAATTGAAGATACCACACCATGGGCAGGTGTGGTGACGGAAAGACCACGAGCTACGAGTTCGGTTCTGGAAAACGAATTTCTTCGTCA
CCAGCTTGTAGCAAAGTCGCATGAGCTAGAGATTCGCAGTCAACATGTGAATGAACTCACGACGGAGTTGACACATTGCCGTGACGAATATGACGCTCAG
ATGGAGGCACTGCAAGACAAGTTACGTGAGTACGATGTCCACTTCCGTAGTCTTGGAGTCCAGAACTCACAATTGGATTCCCTTGTAACGAAAACGAAGA
TGCTGCGCTCGGTTCGTGGAGGAAGCCAACCCAGTCCGTGTGCTGGTCGCTCAAACTCGGAGGACCAGTCAAGACTTTCCAATGTTGGCGGCAGTCTGCG
CCACGACAGCACCACTTCAGCAACGTCACAAAATGAGTGGAAACTGGATGACGAGGTGTTCCCAGTAGCACCCATCGACATGGAGTCTGAAGTCGTAAAG
CGTTTGATTCGAAACATACCCGAAAAGGGGCGAGAGAAGATATCGAAATGGCTGGGATTCGTACTGGAAGGGCGAGATATTCGGTCCAATTTCCACCCCG
AGATCTCAATCGAAAGCATTGACGAGAGCGTCAACCAGAATATGAGAAGATTGATCATACCGTTACTGAAGAACCGCCAAGATCTGAAGGTGCAAGCTTA
CATACGCACGCGTTACGTTCGCGTTTCCGACCTCAAGATCACTCTTGACCATAAGCACAAGGATGAAGTGCGCCTTGAAGCAACTAGCGGCGATGACAGA
GTTGCTGAAGCTACTACACATAACTCGTCGCTCCTGTGGTCTAGAGATCATTTATTCTACGGACCAAAACGAGATGCCTCAGGCCCCTCGGTTCTGCATG
CCAGTCGAGCGCTGGTTTTGTCAAAGGACCGGTTTGCTTCCGAGCCGATTGATCTTAGCGCCAGTGTGACTGGATCCAAGTCAATGTTGGAGGGGGCTAT
TGGAGCCCCAAAGTCTTTGAAACGAAAGCCATCGCTTCCTTTCGACTCACTGGGAGCTCTTGGATCTAGTCCGGGTTCTGGTGGTGTATTTGGTCGGTTG
CGCTCGAAGACGAACA