Description :
Non Conding Region
Location :
Scaffold_1:63244- 63433
Sequence
189 bases(100 bases per row)
TAGACGATTTCGCAATCAAGCTGCTGCATTCCTTGGACTACCTTGAACGGAAGTATTAGCTGGGACGATATCCTTGCTCGTACGTGGCGATAAGGTTCCG
TTGTTTGAGAGCCTGAAATGCACATACATGTAGAAGAAAGAGAGTTCACGCGTTGGTAGCACCAACCTAACGCTTAAAACACAAAATAC