Description :
Non Conding Region
Location :
Scaffold_1:62939- 64871
Sequence
1932 bases(100 bases per row)
GTCAGCCTCCACGACCAACTAATCGGCACACAGAACACGCCATCGTGAGGCCAGAGCGCGTAGAAGATAAGATTCTTGATGCTTCATCAATATGCATTGA
GGCTAAGAGCGTGTATATAAAAAGTAAATAAGAGCGTGTATATAAAAACCAAACAGCCACACCTCGCGAATTGTGCCGTTTAGCGTTGTGGACACTTCGT
CGATTGCTGCATCGACTCTAAAGCGCGTTGAGTAGGCTTCCTCTTGCGCGCCGAACGACGGGATCCTCACAGTAATTCCTGTGCCGGGGGACTTGCTTCT
GGTGCGGGGGCAGAGGATTCCGGAATGGCGCTCTCCGCCACTGGTTCTTCGACGAGAAGCACCGTTTCTGCTGCACTCACACTTAAAGCCGGACTCGCAG
CGCACTCGTGCACCACGTGACCCCCATCATGTTCTGCATCATATGCTTCCAGCACCTGATCCCCCTCATGCTCTGCATAAGATGCCACAATAGAGAATGA
TAGATCCTGTAGTTCTGCCAGGGACACTCCATCCTCTCCATCTGTCTCAGATAATCTCGCTTCGGATGAGAGATCTTCAACTACCATGCGCCGCGTGCGT
CCGTGTCCCGGTCTGACAAATTGACGGCGGTTATCAGCACCCGGACAGTGAATGCGGGATTGGATACATGCAGTGACAATGTGACAGCACATACCGTGTT
TTCGGCTATACGCACATGTGGATCCTTTGCTTCTAGTATCAACAATCCATCCACCACTAGGCATACCGTCAGTCTGCATTCTTCTAGAGTTGATAGATTT
GATGGACTTTTTTATCTGCTTCTTCTCCTCCGCCGTTAATCGAACCGGCCTCTTCATAACTCGGTACAGATCTGCAGGCACATTCCCAACAGGAGGGATG
CGCTCCACTGAAAGGCAACCGTGGTTGTACATAAACCGATATAGTTTCAGCAAGCGGTCCGAGGCGGTGACAATAGTCGCAAAGGTCGCCTCGCGGGTCA
GAAAAGCGAGTCGAGCACCATCCAGATTGTGTATCAATTCCCGAGGAGTTGCCAAACCGTCAGGACACTGCAACTTCACTTTGCGGTGGTACTGCTCCAA
CGGATTGTTGGTTGCAGCATAGCCACTGGGTGTGTAGAACGCCTGCCATCTATAAAATCGTTTTGAATTGACCCAGAATCGTTTCAGATGATCCGTTAAT
TTCCCGGCAGGTGAACCACGTGGGTATCTACTCCACCGGAGTAAAACTCTAGATTTTACTGAGTCAAAATTTTCTTCGCTTGCATAGTGCATGTCAAACA
GGTCTGCGAATATCGAATGTGTATCATCCATGGTTACATGGTGTAGCCGAGCCTGTTTCCACACGTTTTGTGTTACATGAAACCAACACATCAACAGCGT
GGTGCCTGGAAGCTCCGATACACAAGCGTTGAACTGCGCCTTGCAAGCATCCGACATCACAAAGCGGGCTGAAAACTGGGCATTGGATGTGTCAGAGCAC
ACGCGTTTGATATAGCGGATGCACCAGCCTATATCAATCGCACGCTTCTGTGGAGTGCAAAAGTATGCCAACAAAAAAATTGTCCGCATCTATCTGAATA
TCCAAACGCAAAGACCAGGTAGCCATTGATTACCACGCTATGCGTGCTGTCTACGTGAAAAATCGTCGTGCAATCAACCCGACCTTGCACGCACGTCAAT
GTAATCACGGACCAGGTTTAGACAGGTCATGCCAATCCTGAACGGATATGTAGTAGATCCATCGCCTAGATGGGAAATGCTGCCTTCAGAATCAGGACAA
TGGTCAGGCTGCGAGTCGCACAAAATCATTATCTCGCGATCTGACACGGTCTCCAAATCCAGCAGATCGTGTAACGGCCCGTCACACAGCTCGATCACCG
ATGCCATTGAGTTTCTAGGGTTATCCCTCCTT