Description :
Non Conding Region
Location :
contig_1:62662- 62702
Sequence
40 bases(100 bases per row)
CCCCCGCAGGAAGCGAAAGGGGATTCTGAGGTGGCGAGTT