Description :
Non Conding Region
Location :
Scaffold_1:62596- 63415
Sequence
819 bases(100 bases per row)
GATGAAGTCGTGGCGCATCCAACAGGCTGGGTGCTTGATGCTCGTTTTCAGCTTGCTCGTCAGGCTCGAGACTATGCATAGTTGTTTTGGTACATTGCAT
TTAACGGGTGTGCGCGTTCGCGACGTTCAACAGAGCGAGTGATCGATTGTTTGAAGTGCCGCCGACACGTGGAATGACGGCGTCTCGCGACACGCGCCCC
AAATTGAATAAAGCATCCCCATGACCCTGAAAACGGATCCCGGCCGAGGTGTTTGCCAACGCAGTTCCCGGGAGCTACTTCGAGGATGAAGTCGTGTGCT
GCTGGTGTGCGTTTCCCGAATAATCCTGCGTAATAATGATGGCTTGCCAAGTTCGCCCCAAGGCCAAGTCCAGCCGCAACGACCCCAGGCTCGGTAGCTG
TTGGTGTGGCGTAGCGTTAGCAAGAGCGACAGCTACGAGGAAGATACCGTTGACAACAGGCTAGTGATGAATGCCGTTGCAAACAGTAATAGATCAGGAC
ACCCAGTGGTGACGTTGGAGCCTGCTCCAAATGTGCAGGCAGGGTGCTATCCAAATGGAGTGGACCGGTAGACTGTATAGGGTCTGTCACAAGGCGCTGA
TTGGTTGCTGTCGGATACGCTTCTGACTTGACATTCACGCCACGATGGACTTGCTCGGGATCAGGACGGAGGAAGAGCTGCATGGCTGGCTGGTCAAGGG
GGTCTTCGCGCTTGGTGTGGTAACGTATGCAGCGACGACCTTCATCACTGCACCCTACGGGCGTCATCTTCGGCCCGGTTGGGGGCCAACGGTGAACACG
CGCCTCGGGTGGGCCCTGA