Description :
Non Conding Region
Location :
Scaffold_1:6251- 6317
Sequence
66 bases(100 bases per row)
CTCGACGTGTGCGTAATATATACTGTATTGGTGGTTTCTAAGACGTTTACTTGACCTACATCTAGC