Description :
Non Conding Region
Location :
Scaffold_1:62418- 62487
Sequence
69 bases(100 bases per row)
GGCTGAGTCGGGAGGTTTTAATTAGTAATTCTAAGTGTGTTCCAACTGTACTGCAGGCCTTTTGTGTAC