Description :
Non Conding Region
Location :
Scaffold_1:62351- 62639
Sequence
288 bases(100 bases per row)
GCGACCCCATGGTGTGGTACTTCGTTTTGAGATCAGCTTGTCGTTGCTTGAGATCGTGCACTTGCTGCGCGAGACACAGCAATCTCGCCTTGGCACTTCG
CAGCGAGAGTTTGTCCTTCTGGTCGTCCATGAGCTCATGCGGCAGATGCTCCACCTCCTGGATCGCAGCAGCTAATGTCTCCGATAGCCGTTTGTTCTCC
TGCGTGACCTCGTGCAGTAGCTTAGTGTTGGCCGCTGTCTTCTTATTCATAGCGGAGACATCGTTCTTGAGCGAGTCATGTTGACCCT