Description :
Non Conding Region
Location :
Scaffold_1:62330- 63646
Sequence
1316 bases(100 bases per row)
AAACTGCCCACAGGTTGTGAGAAATGGTTCGTTAAACGGTTCAAGGCAGTGCACTGAAAACGTCTATCAAAACATCAAGGAGCAGTCATCGAGTTCTGAC
GCATCAACTGCCGCTTGGCATTCCTTGCGTCTGGGACATGTATCATTTGCCGGTGTTGCACCGATGCATCGATTGGTTGAAGCAGTGTCGACGCTGGAAG
AAGGACCACGCGTTTCGATGGTCGTGCTCCAGTATTCATGATCAAGTCTGACTGGTCACCAAATACCTCCCACAACTTCAAAGTCTATACTCAAGTAACT
CCCTTTCAATTCCGCGCGAGTTTGGTTGTCCATGCCTGTCCATAGCGATGCAATGCAGCGCGCAGGATACGTCATCGCAGACTGCCCAGGAAACCCGACG
CGGACAAATCCACTCAAACTCTTTTGGCAGACCAAACCAAGAATTGTGCAGCAACTATGCAAGTCGAGCAGGTAGGCCAAAGGGACAACTGCTTGGCTGC
ACTCGGCAACTCCAGCACGATGCTCAGAATGCGCTGGATCGCTCACTGATTAAATTCGCCTTGCAGTTATTAGGTCACTGGACGTCGTCTGGACAAGATG
CACGCACAGCACCTGGCTTGAAAGCAAACAGCGGCAGCCAGTCGATCGCTCTGAAATGTAGTGTGTCGGTTAAGCAAACCCATGATGCATTGCTGCGGGC
TTGCGTCGGTCGGCAGATTGCAGTGAAGTCGGGATAGCTCACAGCACAGCGATTTATCGTCATCGTCACAAATACATCCATCCATCGTGGCCGAGACCGA
CGTGTGCCCCCCACTTGACCGCCGCGCCAACATTGTGGGTATACCATCGTCTGAGGCTGCGGCTGAGGGACTCGGCTTGCTTACGGAGAATGTGCGCGCG
CGAGTGTGGAGGAATCCGAACAGAAACTTCAACTCGCAATCCTGCGAAAACGATTTGCTGTTCCGGTTGTGGTATACCATGACACCACCGGGAACTCGAT
GACTCTCTAAATTAGATATCTGATCTCATGATCGAACGTACGGCTGATGTATAATGAGACCTACAGAAACACATTTCGAAGGCTGATCTGATTGGCTGAC
TGCACACGCTTTTCAGATGCGAGCGACGATACAAACTCGAACATAGGGTTACGCTCCGGAAGAGGTACTGTAACCAAACTCTGTTGTCCCGCTCCCGCTT
TTGCCCATCACTTGCACCTCATTCCGCCTCGCGACACTCGGGACGTGAACACGACGAACGATACCGAGCGCGTTTTACAGCCATTCTCTCCCTCGCCTGT
GGCAGCGCGAGCCGGA