Description :
Non Conding Region
Location :
Scaffold_1:62328- 62818
Sequence
490 bases(100 bases per row)
CAGAATGTGTTGTGCACGAGGAGGAAGCGTTGGATCTCCACGCGATGCTTCGCGAGGAAGATCGCCTGGCGGCGGCACTGGTTGGTCGAAATACCCCAAC
GGAAAATATAGAAGGAACTTTGGGATGTTTCGAAAATCGACCCGTGCAAACGACTTGTGGAAAAGCGCTGCACGATCCTAGAGTCGTGGTCCCACTATGG
AGGGAATGATGCGACGCTATGCCGCTGCCACCAGTAAACACCCATGGTGTCCACTGGCGGGAGCGATACAGAACAGAGAGAAGCAGGCCTCGACCAGTCC
TGCGACGTGTGTACGGTAAGTTCGTAACCGCTATTGTGCAAGTTCCTATCCTTCTCCACCCAATCACATGGCCCAGTTCTTTGCGACCGACCCTACCCCT
TCCTCGGCGGGTCCGCCGTCAGGTACTTGTCTGACCAGAGTTCGTCGTGGAGCTGTTCCCCTTGAGCCGACCAGCTCCGATCCGGAACCA