Description :
Non Conding Region
Location :
Scaffold_1:62233- 62384
Sequence
151 bases(100 bases per row)
GTAGGCCACGAGACTATGCAGCATTAATAGAAATCGGAGATACTAACACGCCAACTTGATaaaacaaacagcaacacgcgACTCGGCTGTCATATTTGAC
AACCTGCAATGCGACGAAGCCATTCTACACATTTTTGATTTGTAAACACTA