Description :
Non Conding Region
Location :
Scaffold_1:62046- 62129
Sequence
83 bases(100 bases per row)
TGCTGTATTGATCCACGAATTTAATGAAGTAGAAACGAAAAGAGTGAAATCCCCTAAAGCAAAAGCATTCTCGTTTGCCAAGT