Description :
Non Conding Region
Location :
Scaffold_1:61502- 61711
Sequence
209 bases(100 bases per row)
CGCTGTATGCCTGTACATGGGAACAAACGAGGCAATCCACCCTCAAGAAAAAATAAAATGAATGTGCGTGGCGAGGTTGTACGCACAATGCCGCAACACT
GCTGCTGCCCTCGAAGCTTGCAGCAATGTCTCCCACAAAGTGGAATCTGCACGTACACGATTGAATGTTAATCTATTGCATCCATCGGTTGTTCGAATAA
CTTGTTCTT