Description :
Non Conding Region
Location :
Scaffold_1:61470- 61542
Sequence
72 bases(100 bases per row)
CAAGGTGAAGCAACTGACTTGATATGAAGAATACCCACCACCGAGGAACACTGATCCATGCTATGAATGGCA