Description :
Non Conding Region
Location :
Scaffold_1:61287- 62014
Sequence
727 bases(100 bases per row)
TTCATTGCCGACCTATTGATGAAgCGCTGGCGTCCTAGCGATTCATACGGGTtCGCAACGCGCCTCGCGACTGCGAACGCCTTCCTGTCAAGCTCCTCGA
AGCTGAGCCAGTGTAGCCATACGTCaGAGTTATAAAGCTGAACAATAATCTGACGTCCACAATACCTCGCTTtAGTGGCGTCCAGCTCAATGAGGATTTC
CATGGATGGCGCTGGTAATGACCACATGAGCTCCTTGGTGGTCCCcTCTGCAAGCGCTCCATTCTGCCCTCCACCGTTGTCATCTCCAACGAACAGCTTC
AACAGCTGCTTGGCATCGCTTCCTTCATGCTTGGTGAGCACTGAGACCCCTCTCGACGTGATGCGGACACAaTTTGCGAGCGCATCTCCATCTGATGGCT
GGACGGCAGTTCCTGGCACCACATGATGCAGTTCGTGTTCGGAATGTGGCCGACATGAAACGCTTGTGTCGTGGTCTCCATCACAAATGCGCTCGTCTGA
ACGCTCGTGACGTCGCGCCCGTTTGTGAGGCCTCCCGAATGAAGAGAACCCCATCAACGCACGCATCTCATCCTCCATCCTTCGTCTTGAGACGCTGCGT
CCTCATAAATGACAACCAATATCCAATTCAATACGAATGCGGATTGCTATATTACGCCAATTGCTCTATTCTCTGTGTGTAGGTCTCTCCATCCAcGCCA
TTCATCCATCCACGTAAGTTCGCTCCT