Description :
Non Conding Region
Location :
Scaffold_1:61275- 62160
Sequence
885 bases(100 bases per row)
TTGCTGTCTTCTGGGGGGCGGGCGAGGCGCTTTGTGCTGCTCTACGAAATGGGAGGACCACCAGCACGCTCGAGACCCCACGTTGATAGGGCCGCGATTT
CCGACTTTTAAGGGGAAACCCGAAATATAGAGATTACTCGTCTTTGTCTCCGAGAAGTCGCTCCCTGGGCCTTACAAATATACCATACTGGGTGCAGGCT
GCGGAGTGAAGAGTTGAGGGATACGTGATGGGAAGATGAGTTCTATTTTCATGCCAGAATATGAAATGTCCACACTAAATGCAAAATACCGTGATAATCT
CCATTTTCTGGTGGTGTTGCCCCAGTGCTCGCACCATGCTCGCACCATGCACTTCATGTTATGAAGTTGCACACGCCAGTGGCATTTGCTGTCGTTGCGC
ATTGCTTGCATTCACTAAATAGTCAAACACAGCTTTTGCTCGTCATTTCACTTCCGCGACACCGAGTCGTTTTCAGAGAGAAAGCAAGCATGGTGTTCTT
CGTAAGCGGACACTCAACTTTATCAATCAGTGTATTCTGCTCTGGCGTATATAGTGATGTACGGCGACCCAGTAAACATTTACTACACAGTTCGATACGT
TGATAGTATTGTAGCGCTGAGAAGAGCTGCTGTTATTATACCAGGCTGGCAATTCCATGGCATCTACGCTGGGTGTGTGATGCTTATAAACCTGGTGCAA
GAGCTACAGCAAACTCTAGATGCTTGCCGGCGCTAAAGCATCGTTATCAGCCAAATTCCACGGTGAATAGATGTACTAGAATACCGAGAACTCAAAGCAG
CAGACTTTGTAGCCAATCAGCAGTCGTCGACTGGCGAGGATCAGATGCAAAATCGGCCAAAAGTCAACCCTTTCAACCAAGACGA