Description :
Non Conding Region
Location :
Scaffold_1:61273- 61620
Sequence
347 bases(100 bases per row)
GCGCCAAACAAGAAGTGGGCTCGAAGAATGTACGAGCGAAGCGCTCGATCCAAGCTTCCCGCCATTTGATGGGGGGGGGTGTTCCACCACCAAACAAACG
AGAAGCACCACTAAAAATAATTCTCGATACACCAAAATTACCTACGTAAAGCACACTGCATACCGAATTGGAGTATCCACCCGTGAGGAGGTGTGGAGCC
ACCCAAATGAGTGCTTAGTGTCACCGTGTACCTTCACCAACTCACGAACTCACCGTATCACGAATGTCGAGCTCATCGCGGACGTGAACCAGAGCGTCAG
CTTCACGCCCAACGACTGCTTCTGGATCCCCGGACCGGCGCGCTTCA