Description :
Non Conding Region
Location :
Scaffold_1:6111- 7345
Sequence
1234 bases(100 bases per row)
ATATGTGCCTTCAACGTGATATCCTTCACCGTTTTCCTTAGTTTGGTTAGTATCCTTGTTCGTGCGAGGCGATGAGATTCCGCTGTTGAAGgttcttcat
gaagatgaaAATGTGTTTAAGACGatagcagcaatggcaattGTACAAGACAACGCACCTCGGCAATTGGTGTCATTGTATCCGCATCGAACACTCGGAA
ACGTACAGGCGGCGTAGGCGGTCGATCTCTTCGCTTGtgtttgcgctgctcgagtgcCAGTTGCAGATCCACGAAAACTTCAGCCTCTGCTCAAAAGCAG
CCGTGAAAACTCAAGCACAAAACATGAAATGTAGTAGTATGCAGTCCGTACCCACACGTGGGATGGCGAATCCTCCATTGATCACCATCGCGTGAAGCTT
GATCGCTGAATGTTGTGGTGGAGCGATACGGATCACACGGTACTTGGTGTCCAAATGCTGGTGCAGGAACCCTACGACAGTCTCAAACTACGATGAAAGC
GTGGCGTCAGAGGACATCGGATTCACTTTCCAGAGCGCAGAAGGTCAACCTACATCCTGCTCGATATCTGCCCCACGCCGTCCACGCTCGCCTTCTAGTC
GTGACAAGCGGTACGTAGCAAGCAAGATGGCTACGAGGATCACTGCAAAAGAGATCGAGCACACATCAGTCGCGGCGATCATCCATGGCACAGTGCTTCT
TCCCTACCCAGCGCACGCATTCGCAACGAGTCCAGCATGGTCGTGCTTTAACTGGAGCCGACTTTAAAACAGACTTTCGTCCGCGGCGGTCGTGAGCAGA
ATCAGTGCGCGGAGAGAGATCTCCTTCGCTTGTGAACGCAGTAcgacacgtcgtcgacagtGGTGTCAAGTGTATCGAAGTGTTATCGCGGATGAGGCGT
CACCTTCTCTGCCGGTAGCGGCACGTGGAGACTGTTCCGGAGCGTGTGGCTGCCACGCGCTCAAGATATTTTTTCGCATGAGGATCGACCTCCATTGACG
ATACCAAACCAGGTCGGCCCCCTTGGTCGGCTCGTGTTGAGCTTGACCTCGGAcagtggtgctggagacgatCCAATACGCAGCTTTCAATGCAATGCAG
GACAAGTTGCTCTGTTGGGGCGGTATGAACGTCAAGGTAGATAATATATACATTTGCCAATTAGGTGGGATGGATAGTAGCGACAAGGAGGCTTTCGCCA
CGCAGCggttcctcctccagtcgcGTCAACGTCT