Description :
Non Conding Region
Location :
Scaffold_1:60914- 61662
Sequence
748 bases(100 bases per row)
GCGAACTTGAACTGATACTCGGCGCTTCGCGGCTTTAGATTGCGCTCTGTCCGTTTCTGTTTTTCTACCAGCCTCAGTGTGGAATGTGGACGGAAGGTCG
TACGAGGTTGGCGCAACAATCCCCCTCGCTGGGCTTTTTTCCAGCGATTCGTGGCTCACTCCACGAAGAAACCTTCAGGTACGACTGCAGCCAGCTTCTA
CGCCTGCCTCGGCGCTCTATTCCCTGCTACATTTAGCTCACTATGCTGACTTCCGCCTTCCTCATGCTCTGCGCTCAGTGAATATCCCCCCTCAGAGACC
AAGATGTCGTCGATCCTAGCCTCCCTCGACATGAGCCTGGACGACCTGATCGCTCAGAAGAAGACCCGTGCCTCCAACCCGGCGTCGCGCCCGGCCAAGG
CCAACAAGGACAAGGAGGCTGCCGGCCCCATCCGCGGCGGCCGTCGGCGCAACCGCAGCCGCAACCAGCCCTACTCGCGATCTGTAAGTGTCGCGTCGAC
CTGAAGGGCTCCCGCCTCTCGGTCTATTTCTCCCCCTCTCCGTCTTCCTGCGCTACGGACAAGGCAACCTACTCCCTCTTCGGTCTCTGCGCTGGTCTTG
CAGAGCCTCTCCTTTGCGGGGAGCACGGCGCCTTGCTGGTAGCAACGGGGACGGACGTTACGATGCGTTGGTGCAGACAGAAATTCACACGTGTGCTGCT
GCTTCTCCCTTGCTGTCCCAAAGCGCGGCGGCAATGACGACGACGACA