Description :
Non Conding Region
Location :
Scaffold_1:60428- 61516
Sequence
1088 bases(100 bases per row)
gttgatgatgatcagcgaTGTCTATTTAACGTTAGTCATTAGGTCtctgaaatatctcgagccaccgcgcgatgggtggttcttgccgtcttcgtacggt
CTGTAGCGGCAGACTTGATCTTCTCGCCTTTAtttccatgtactcgaaactatctaaaacttggcgcattcgaataccttgcatctttgtctcaggtcgt
ttggagtctcgtagcgctgctgctctcaattgcctcatcgtcattttccatattgcttgttgactttgttccgctgtgatttcttcatggcggaagATGA
CTCAgttccgttgcatccaaagNGTTGAGCTGTCCCAAAGCGACTCGGTACGCCGTCCACAGttggaagtcggtgagggtcCGCTGTCTAGCCCAGAGTT
CTCTAGGTCTTTGGTCCTGCGTCACCATTACCCACTCTGAAGTATCTCGACGTTCTTTCAATTTTTCCACTatgggtcgaagttgtttgctgatttcATG
CCGCtagcgtcgaaatggttgccgGTTTAGCGCATTGAGCACGCGCTTATTTGTGATTTTGTCACTCAGTTCCTatggaaatccatggagaagcgATGTG
GCGTCCAGGACTATGCCTTCAGTCACGCCGTAGTCTCAATACTTTACCACGGTCGAGTAgttctctgtttccagtaacgtctccaagctgccagttgatt
cCTTCAGGTGCTCGGAGGATCCCTATCGTCccgcttgctgctgtgcctAGTGTTGGCCGTCCTTGTACCCTGCCAGGTCCTGCTACTTCCCATGTGTAAG
GTGTTGTCAAGCAATCGAGTATTGTTGCAGTGTTACAACCTGCTTCTGGTGACGCATCCACCTTGTTTTGGCAATAGAAATGTTGACGTATCATTCGATA
AATAATGATTTGACCAATCATAAATTTATCCTCTAATTTTGCATACGTAAAACAACGTTGTTTTAATGAGACTTCGCCACAACGTCAGTGCTCAATTTAT
CCGTCTAGAATCATGAGTTCCAGTACTTCACCACCTAACAAACTTCGTGTATTGTGCCTCCATGGATTCCGCACCAATCGACAAATAA