Description :
Non Conding Region
Location :
Scaffold_1:60333- 60500
Sequence
167 bases(100 bases per row)
GTTCGATACATTGTCTGCGACGGTAATGGATCCGTCAAAACACACCCAAGATTGCACCCAAGCAGATCTTAGTGCTGCGACACCAAAGGGCAATGAGCTT
CAAGTCGCCTCACAGCGTGCCACGTCACGTGGCCCGTTTCGGAAAAACGGCCATTTGGGTGTTTTCG