Description :
Non Conding Region
Location :
Scaffold_1:60178- 60825
Sequence
647 bases(100 bases per row)
GTGACACTCTATCAAGACTACTCATGAGCTGCCTGGTCAAGCAGTCCCCAACTCTGACAATAGGCATCGACGTTTAGTCGACGAACTCGGTATTTTCCTG
GAGCCTCTGTCGCAAGTTTGATTATTTCTGTGCATGCAGTAAGCTGTTGACGAGCAATACGATCGCTCGAATGCTGCATGTACTCTTGAAATGCTGAAGT
CAGTGGAACCAGCGAATTGAAGACAAACGAATCGTCAGCGTGTCCAGTTGCAAACTTTGTCAGCATGTCCTCGAGTCGAGTAATAATTTCTGGAATAGGA
AGATCTGAATGCAATTGTCGTGCGACAACGTATCGTTCCGAGCTCGCGAGTCTACTTGTCTAGGTGAAACATCAAAAGTAAGTCAACGTAAGCCACAACT
AACGTGCTTAAAGCGTGGGGAACTCACCACGGGCTTCACAATTGAGAAATCTTCAAAGCATTGATGCAAAATCCAAACAAGCTGTAGGGAGAGTGGTGAC
GAAAGCTCAAACGTTTTGAGAACGAATGAACCGCCGGTCCTCAAGACGTGAAACATGGTAAGAATCTCCGCAACCACAAGTCGACTCATAAGCAATTCCT
GAAGTTATAAGAGAGCTGGTAAATAGACATTATGACTTCTTCCCATT