Description :
Non Conding Region
Location :
Scaffold_1:60001- 60484
Sequence
483 bases(100 bases per row)
GGAGGTGATGGTGCAATGTACGTCCAGTGCAGCTCTACCCTCGCTGCGTTCTCGGCAAAATCTCAAGACTGGGCGCAGCAAGAGGACCAACAGTTTTTAA
GTAAACGCCGCGCAATGGTGGCGTATATCTGTAGCGAAAGACATGTCAATTTTCTCTTTCAACATGTGAAGACGTTGAGTAGTTTACCTGGCGTTCACCT
TTGCATCGTAGCGGACAACATCGCTGTCATATTTGTAGTACATTGGCGGGAGAGGACCATTGGCAAGGGTGTGGGGTAAGTACCATCGCAGCGGTGCTGT
CCATCAGATGGATGGTGCTTCTCTTGCTGTGAGTCACAGTCGACATGAAAGTCTTGTGTGGCTTCCGGCATCATCCCCATCGGAGCTTAGTGCTGCGCTT
TGCCTGCTATAGGGCGGGAGCTCGAGTTTTTCGAAGCGAGCTGTCAGCGGAGCGAGGCGACAGTGCCGATAAGTCGGCGTAGA