Description :
Non Conding Region
Location :
Scaffold_1:59998- 60384
Sequence
386 bases(100 bases per row)
GATATCGTGAGACGTTCGAGGCGTTCGTTAGAGCGCGCCTTTGTCGCTCGACACAGTACGGCGTGGCGGTGGCAAACGCACCGGAAAAGAACGAGAGTAG
GCGTTTGCGACAGGGCTTGGCCGCGCGCCGCCGCGTGGACGGCGAGTCCTCCGAGAGGCGATACGGGTCCATTGTTAGACGGTATCTTTCAGCCTCGTTA
ACGCTTGGGAGGAGGAAATCCAGAGTGTCTGTTCAGTGAGTGCCTGCCAGCCGCGGTCACTCCTGCGAACCCAAACGGCGTCTCTCCCGCGATTGTCGAA
GAGCGACCAGCTGCTGATACTCTCTGGGTGAGCTCCATGGCCAAATGAAAGAGATTGACCTGACCTGCTCTTTATTTCTCCTCCCT