Description :
Non Conding Region
Location :
Scaffold_1:59963- 60900
Sequence
937 bases(100 bases per row)
AATATGAATTTGGTCGAGAGAGAAAACAGAGATGTGGTGGACGAGCACCATCACTCACGGTACCACGCTCCTCGGACTTGAGCGATGGTGCGGTTCTGGC
AAAGTCGCCGTGCTAGCTACCGGTACGGCTTCGTTGGAGCGTTCGGCCCTTTCGCGCTCGCAGGCCTCTTCCAGGCCTGGCGGTCGCCACCAGACTAAAC
CTAGTCGGAGACGCATGGCGGCGAGGCGTGAGACGTGAGACTTGCTGTTTGGTTTGGTGCGTAGCACTTTTCACCGAGGTCAATATGGTATGTGGAATCG
CCCTCGGCGACGACTTGATATTTGTCGGCTGCCACATTCGGTGTATCATTTCCAGAGGCCAAGTCTGAGACAACAGAAATGGTTGACGACCACCTTTCGA
CAAATGTAGTTTAGTGTTGTGAACTCGTGATGCCCTGCTGTGGGTATATTCACAAACAATGACAATCAAACTACTCGTTTGTAGCCTTTGCGTTTCGATG
TATATCCTATTCCATGAGAAATCGTGTTCTGAAAATGCACATTTCTCGAGTTAGCAAAATTTTAAACACGGATATCTCGAGCTCCAGGTCTCGAACGGAG
GTGCTACAGCGCATTTCGTCATCTCCAAAACATGCTTCTTCGACCTGCCAAGTTGCAGCTATTTCGATTTCAAAGTCGATCTGGCCTCCTCGCGGCCGCC
AGATCGTCGTGCTGCGCCTTCTCTAGCTTATGCTTGGTGCTGATTGGTTTAAAATACAATAAATATGGCAAATCCAATCCATCGTTTGAGTATCAATCCC
ACTGGAGCTTGTTTAAAACAGCTCTGTTTTCAACGCGCCCGATTGGCTGAAATGGAAAAAACACCCTGTCCACATTGGGTGCGCTTTTCTGGAAATCCCG
GTGCGGCTTTCGTCCGATTGGTTCAAGTCCAATCCAG