Description :
Non Conding Region
Location :
Scaffold_1:5969- 6760
Sequence
791 bases(100 bases per row)
CGACGGGCTCTGTTCGCCATATCTTGTCGCCAAACTTGTGAGCTTCGACGTTTATCGAGTACTTGAATCGTTCTGAAAGACCACCGACACTACAATAAGC
ATTCACCCCAATACATTACGTGTGCAAAATTTCATCGAATTCCTCTTGCCAACGAGCTCAACCACCACGGCCGAAGCCACAGTCCATCAGGAACCCCTTC
ATGTCATCGCGAATAGCGTCACCAGAGCGTAGGTTGCACTGAATGCTCGTGTCCAACGAGACGATATGGTGATACCAGAACGATGGCAGATACAAAACCT
CGCCAGCCGTGAGCGCCACCTCCGCCGCGGGACAATTGCGCGCGGTCTCGGGCAGGACACTCGTGTCCGACCAGTTGAACGTCGTGTGACGCGCAGACTG
ACCCGAAGTCATCAGACCCAGGCACTTGCACGAGCTTGGCGGGGATATCACATAGCGCTTGGTTCCACGGATCATGGAGATATGGTTGAAGCCGCCATCG
ATGTGACCCTCAGCAATAATACCTCGCATTCCAAGACGACAGCGCATCCCGTGCTCCTTGGCGATAGAGACATCTCGAATATAGAGGTCACCGAAGCGTG
GGTCGTGCTTTGGTTGCACTGCGCTCAGGAACCGAAGATCTTCGTAGATGAATGCTGCTCGGTTCAGAAAGTCGTTCTTCTTCAGCATGAAGTAGTAGTA
CTCGTGCGGTTCCCCAAGTTCCTCGGGTAGCTTGACATCGTTCACCGCCTTCACAAACTGCGGGTACGTCATCCAGCGCGACTCATAAGGG